RegulonDB RegulonDB 10.9: Gene Sequence
ftp gene sequence


Size: 1056        A: 270  T: 222  G: 290  C: 274

Fasta

 

>ftp E. coli K12. Version NC_000913.3 GI:556503834
atggaaataagctttacccgcgtggcactgctggctgccgcgctcttctttgttggttgc
gatcaaaaaccacaacccgccaaaacccacgctactgaagttaccgttcttgaaggcaaa
actatgggtaccttctggcgtgccagcatcccgggcattgacgccaaacgcagcgccgaa
cttaaagaaaagattcagacccaactggacgccgacgatcagctgctttcgacctataaa
aaagattccgcgctgatgcgctttaacgactcgcaaagtttatcgccgtggccggtaagt
gaagcgatggccgatatcgtcaccacctcgctgcgcattggcgcgaagaccgatggcgcg
atggatataaccgtcgggccgctggtgaatctgtggggctttggcccggaacaacagccg
gttcaaattccgagccaggaacagatcgatgcgatgaaagccaaaaccggcttacagcac
ctgacggtcatcaatcagtcgcatcagcaatatctgcaaaaagacctgccggatttatat
gtcgatctctccaccgtcggcgaaggctatgcggccgatcatttggcacgcttgatggag
caggaagggatttcccgctatctggtgtcggtgggcggcgcgctgaacagccgtggtatg
aacggtgaaggcctgccgtggcgggtagcgattcaaaaaccaaccgataaagaaaacgcg
gttcaggctgtggtggatatcaacggtcatgggattagcacctctggcagctaccgtaac
tattacgaactggacggcaaacgtctttcccatgttatcgatccgcaaaccgggcgtccc
atcgaacacaatctggtatccgtgacggtgattgctccgacggcgctggaagccgatgcc
tgggatactggcttgatggtactcgggccggagaaagctaaagaggttgttcgccgggaa
gggctggcggtttatatgatcaccaaagaaggcgatagctttaaaacctggatgtcacca
cagtttaaaagcttccttgtcagcgaaaaaaattaa
              
                            

Download fasta file
RegulonDB