RegulonDB RegulonDB 11.1: Gene Sequence
nikC gene sequence


Size: 834        A: 116  T: 210  G: 266  C: 242

Fasta

 

>nikC E. coli K12. Version NC_000913.3 GI:556503834
gtgaactttttcctctcttcccgctggtcggtacgcctggcgctgatcattatcgccctg
ctggcgctgattgcgctcaccagccagtggtggctgccgtatgacccacaggcgattgat
ttgccgtcgcgcctgctttcgccggatgcgcagcactggctgggcaccgatcacttaggt
cgcgatattttctcgcggctgatggcagcgacccgcgtgtcgctcggttcggtaatggcc
tgcctgctgctggtgctgacattagggctggttattggcggcagcgccgggttgattggc
gggcgcgttgatcaggccaccatgcgcgtcgccgatatgtttatgaccttcccgacctcg
attctgtcgttctttatggttggcgtgctcggcaccgggctgaccaacgtaattatcgcc
atcgccctgtcgcactgggcgtggtatgcacgcatggtgcgcagcctggtgatttcacta
cgccaacgcgagtttgtgctggcgtcacggctttccggtgcgggccatgtgcgggtgttt
gtcgatcatctggcaggcgcggtgatcccttcgctgctggtgctggcaacgctggatatc
ggccatatgatgctgcacgtcgcggggatgtctttccttggcctcggtgtgaccgcgccg
accgccgaatggggcgtgatgattaacgacgcgcgccagtatatctggacccagccgctg
caaatgttctggccggggctggcgctgtttatcagcgtgatggcctttaacctggtgggt
gacgcactgcgcgatcatctggaccctcatctggtgacggagcacgcacactaa
              
                            

Download fasta file
RegulonDB