RegulonDB RegulonDB 10.9: Gene Sequence
recX gene sequence


Size: 501        A: 128  T: 113  G: 140  C: 120

Fasta

 

>recX E. coli K12. Version NC_000913.3 GI:556503834
atgacagaatcaacatcccgtcgcccggcatatgctcgcctgttggatcgtgcggtacgc
attctggcggtgcgcgatcacagtgagcaagaactgcgacgtaaactcgcggcaccgatt
atgggcaaaaatggcccagaagagattgatgctacggcagaagattacgagcgcgttatt
gcctggtgccatgaacatggctatctcgatgacagccgatttgttgcgcgctttatcgcc
agccgtagccgcaaaggttatggacctgcgcgtattcgccaggaactgaatcagaaaggt
atttcccgcgaagcgacagaaaaagcgatgcgtgaatgtgacatcgactggtgcgcactg
gcgcgcgatcaggcgacgcgaaaatatggcgaacctttgccaactgtcttttcagaaaaa
gttaagatccagcgttttctgctctatcgtggctatctgatggaagatatccaggagatt
tggcgaaattttgccgactga
              
                            

Download fasta file
RegulonDB