RegulonDB RegulonDB 10.9: Gene Sequence
ppdA gene sequence


Size: 471        A: 106  T: 110  G: 139  C: 116

Fasta

 

>ppdA E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacacaacgtggttatacgctgattgaaacgctggtcgcgatgctgattttggtc
atgctaagcgcaagtggactctatggctggcaatactggcagcagtcgcaacggctatgg
caaaccgccagccaggcgcgggactatttgctctatttacgtgaagatgccaactggcat
aaccgcgaccacagtatcagcgttatcagggaggggacgttatggtgccttgtgagttcc
gctgctggggccaatacctgtcatggcagttcaccattggtctttgtgccacgctggccc
gaagtcgaaatgagcgacctgacaccttcgcttgctttctttggcctgcgcaataccgca
tgggccgggcatattcgcttcaaaaactcaacgggcgagtggtggctggtggtttcgccg
tggggaagactccggctttgtcagcaaggagaaacagaaggatgcctgtaa
              
                            

Download fasta file
RegulonDB