RegulonDB RegulonDB 10.9: Gene Sequence
nuoA gene sequence


Size: 444        A: 77  T: 130  G: 124  C: 113

Fasta

 

>nuoA E. coli K12. Version NC_000913.3 GI:556503834
atgagtatgtcaacatccactgaagtcatcgctcatcactgggcattcgctatctttctt
atcgttgccattggcctgtgttgcctgatgctggtaggcggttggtttttaggcggtcgc
gcacgcgcgaggtcgaaaaacgtgccgtttgaatccggtatcgactcggtcggctccgcc
cgcttacgcctgtccgccaagttttatctggtggccatgttcttcgttatcttcgacgtt
gaagcgctgtatctgttcgcatggtcaacctctatccgcgaaagcggctgggtaggcttt
gtggaagctgcaatttttatttttgtgttactggcaggtctggtttatctggtgcgtatt
ggcgcgctggactggacgcccgcgcgttcacgccgcgagcgtatgaacccggaaacgaac
agtatcgctaatcgtcaacgctaa
              
                            

Download fasta file
RegulonDB