RegulonDB RegulonDB 10.9: Gene Sequence
nuoE gene sequence


Size: 501        A: 125  T: 99  G: 150  C: 127

Fasta

 

>nuoE E. coli K12. Version NC_000913.3 GI:556503834
atgcacgagaatcaacaaccacaaaccgaggcttttgagctgagtgcggcagagcgtgaa
gcgatcgagcacgagatgcaccactacgaagacccgcgtgcggcgtccattgaagcgctg
aaaatcgttcagaagcagcgtggctgggtgccggatggtgcgatccacgcgatcgccgat
gtgctgggtattccggcaagcgacgtcgaaggtgtggcaacgttctacagtcagatcttc
cgccagccggttggtcgccatgtgatccgttattgtgacagcgtggtctgtcatatcaac
ggttatcagggtattcaggcggcgctcgagaaaaagctgaacatcaaaccagggcaaacg
acatttgatggccgctttacgctgctgccaacttgctgcctggggaactgtgataaaggg
ccaaacatgatgatcgatgaggacactcacgcgcatctgaccccggaagcgatccctgaa
ctgctggagcggtataaatga
              
                            

Download fasta file
RegulonDB