RegulonDB RegulonDB 10.9: Gene Sequence
nuoG gene sequence


Size: 2727        A: 610  T: 579  G: 803  C: 735

Fasta

 

>nuoG E. coli K12. Version NC_000913.3 GI:556503834
atggctacaattcatgtagacggcaaagaatacgaggtcaacggagcggacaacctgctg
gaagcttgtctgtctctgggccttgatattccttacttttgctggcatccggcgctggga
agtgtcggtgcttgccgccagtgtgcggtgaagcaataccaaaacgcggaagacacgcgt
ggtcgcctggtgatgtcctgtatgacaccggcttccgatggcacctttatttccattgac
gacgaagaagcgaaacagttccgtgaaagcgtggtcgagtggttgatgaccaaccacccg
cacgactgtccggtatgtgaagagggcggtaactgccatcttcaggatatgactgtgatg
accggacacagcttccgtcgctaccgtttcaccaaacgtacccaccgtaatcaggatttg
gggccattcatctctcacgaaatgaaccgctgcatcgcctgctaccgctgtgtgcgttac
tacaaagattacgctgacggtacagatctgggcgtttacggtgcgcacgacaacgtctac
ttcggtcgcccggaagacggcacgctggaaagcgaattttccggtaacctggtcgaaatt
tgcccgaccggcgtatttaccgacaaaacgcactccgagcgttacaaccgtaaatgggat
atgcagtttgcgccgagcatctgccagcaatgttccatcggctgtaacatcagccccggt
gaacgttacggcgaactgcgtcgtatcgaaaaccgttacaacggtacggtaaaccactac
ttcctctgcgaccgtggtcgtttcggttacggttacgtcaacctgaaggatcgtccgcgt
cagccagtacagcgtcgtggcgatgatttcattaccctcaacgccgaacaggcaatgcag
ggcgcggcagatattctgcgtcagtcgaagaaagtgatcggtattggttctccgcgtgcc
agcgtggaaagcaactttgcgctgcgtgaactggtgggcgaagaaaacttctacaccggt
atcgctcacggtgagcaggaacgtctgcaactggcgctgaaagtgctgcgtgaaggcggc
atttatactccggctctgcgcgaaatcgaatcttacgatgcggtactggtgctgggcgaa
gacgttacccagaccggcgcgcgcgtcgcgctggcagtgcgtcaggctgtgaaaggtaaa
gcgcgcgaaatggcggcagcacagaaagtggctgactggcagattgcggcaatcctcaac
atcggtcaacgtgcgaagcatccgctgtttgttaccaacgttgatgacacccgtctggat
gatatcgcggcgtggacttaccgcgcaccggttgaagatcaggcgcgtttaggttttgcc
atcgcccatgcgctggataactctgcaccagcggttgacggtatcgaacctgagctgcaa
agcaaaatcgacgtcatcgtgcaggcactggcaggtgcgaagaaaccgttgattatctcc
gggacgaacgccggtagcttagaggtgattcaggcggcggctaacgtcgcgaaagccctg
aaaggtcgcggcgctgacgtcggtatcaccatgattgcccgttccgtcaacagcatgggg
ctgggcattatgggtggcggttcgcttgaagaagcgttaaccgaactggaaaccggacgc
gccgacgcggtggtggtgttggaaaacgatctgcatcgtcacgcttctgctatccgcgtg
aatgctgcgctggctaaagcaccgctggtgatggtggttgatcatcaacgcacagcgatt
atggaaaacgcccatctggtactttctgctgccagctttgctgaaagcgacggtacggtg
atcaacaacgaaggccgcgcccaacgtttcttccaggtttacgatcctgcttattacgac
agcaaaactgtcatgctggaaagctggcgctggttacactcgctgcacagcaccctgctg
agccgtgaagtggactggacgcagctcgaccatgtgattgacgctgttgtggcgaaaatc
ccggaactggcaggtatcaaagatgctgcgccggatgcgacattccgtattcgtgggcag
aaactggcccgtgaaccgcaccgttacagcggtcgtaccgccatgcgcgccaatatcagc
gttcatgagccgcgtcagccgcaggatattgacaccatgttcaccttctcgatggaaggt
aacaaccagccgactgcgcaccgttcgcaagtgccgtttgcctgggcgccgggctggaac
tccccgcaggcgtggaacaaattccaggacgaagtgggcggcaaactgcgctttggcgat
ccgggcgtgcgtctgtttgaaaccagcgaaaatggtctggattacttcaccagcgtaccg
gcacgcttccagccgcaggacgggaaatggcgtatcgcgccgtattaccacctgtttggc
agcgatgaattgtcacagcgtgctccggtcttccagagccgtatgccgcagccgtacatc
aaactcaacccagcggatgccgcgaagttgggtgtgaacgcaggtacacgcgtctccttt
agttacgatggcaacacggtcacgctgccggttgaaatcgccgaaggactgacggcaggg
caggtgggcttgccgatgggtatgtccggcattgctccggtgctggctggcgcgcatctt
gaggatctcaaggaggcacaacaatga
              
                            

Download fasta file
RegulonDB