RegulonDB RegulonDB 10.9: Gene Sequence
nuoH gene sequence


Size: 978        A: 171  T: 277  G: 286  C: 244

Fasta

 

>nuoH E. coli K12. Version NC_000913.3 GI:556503834
atgagttggatatcaccggaactgattgagatcctgctgaccatcctcaaagcggtggtg
atcctgctggtggttgtcacctgcggggcattcatgagctttggcgaacgtcgcctgctg
ggtctgttccagaaccgttacggacctaaccgtgttggctggggcggttcgctccagctg
gttgcggacatgatcaaaatgttctttaaagaagactggatcccgaaattctcggatcgc
gtcatctttaccctggcaccgatgattgcctttacctcgctgctgctggcctttgcgatt
gtgccagtcagtccgggttgggtggttgccgacctgaacatcgggattttgttcttcctg
atgatggcaggtctggcggtttacgcggtgctgtttgcgggctggtcaagtaacaacaaa
tactcgttgctgggtgcgatgcgtgcttctgcgcagaccctgagctacgaagtgttcctc
gggctttccttgatgggcgtggtggcgcaggccggttcattcaacatgaccgacatcgtc
aacagccaggcgcatgtgtggaacgttatcccgcaattctttggttttattacctttgcc
atcgcgggcgtggcggtatgtcaccgtcacccgtttgaccagccggaagccgagcaggaa
ctggcggatggttaccacattgaatattccggtatgaagttcggtctgttcttcgtgggt
gagtacatcgggattgtgaccatctctgcattgatggtgacgctgttcttcggtggctgg
caaggcccgttgttaccgccattcatctggttcgcgctgaaaaccgcgttctttatgatg
atgttcattttgattcgtgcgtcgttaccgcgtccgcgttatgaccaggtaatgtccttc
ggctggaaaatctgcctgccgctgacgctgatcaacttgctggtaacggcggctgtcatt
ctctggcaggcgcaataa
              
                            

Download fasta file
RegulonDB