RegulonDB RegulonDB 10.9: Gene Sequence
nuoI gene sequence


Size: 543        A: 133  T: 115  G: 151  C: 144

Fasta

 

>nuoI E. coli K12. Version NC_000913.3 GI:556503834
atgaccttaaaagaattgttagtaggtttcggcacccaggttcgtagtatctggatgatc
ggcctgcacgcgttcgccaaacgcgaaacgcgaatgtacccggaagagccggtctatctg
ccgccccgttatcgtggtcgtatcgttctgacccgcgacccggacggcgaagagcgttgc
gtagcctgtaacctctgcgcggtagcctgcccggtcggctgtatctcgctgcaaaaagca
gaaaccaaagacggtcgctggtacccggaatttttccgcatcaacttctcacgctgcatt
ttctgtggtctgtgcgaagaagcctgtccgaccacggcgattcagttaaccccggatttc
gaaatgggggaatacaagcgccaggatctggtttacgagaaagaggatctgctgatctcc
ggtccgggcaaatacccggaatataacttctaccggatggcaggtatggcaatcgacggc
aaagataagggcgaagcagagaacgaagccaagcctatcgacgtcaagagcctgttaccg
taa
              
                            

Download fasta file
RegulonDB