RegulonDB RegulonDB 10.9: Gene Sequence
nuoJ gene sequence


Size: 555        A: 109  T: 147  G: 169  C: 130

Fasta

 

>nuoJ E. coli K12. Version NC_000913.3 GI:556503834
atggagttcgctttttatatctgtggcctgatagccatacttgcgaccttgcgagtgatc
acccataccaatccggtacacgcactgctgtacctgattatttcgctgctggcgatttcc
ggggtgttcttctcactgggcgcttacttcgccggtgcgctggaaattatcgtctacgcg
ggtgccattatggtgctgttcgtgttcgtggtgatgatgctcaacctgggcggttcagaa
atcgaacaggaacgccagtggctgaaaccgcaggtgtggattggtccggcaattttgtcg
gccatcatgctggtggtgattgtttacgccatcctcggtgttaacgatcagggtatcgac
ggtacgccaatcagtgctaaagcagtgggtattacgctgttcgggccttacgtactggcg
gtggaactggcttctatgctgctgctcgcaggtctggttgtggccttccacgtcggtcgt
gaagagcgtgcgggtgaagtgctgagcaatcgtaaagacgacagcgcgaaaagaaaaacg
gaggagcacgcatga
              
                            

Download fasta file
RegulonDB