RegulonDB RegulonDB 10.9: Gene Sequence
nuoK gene sequence


Size: 303        A: 59  T: 78  G: 82  C: 84

Fasta

 

>nuoK E. coli K12. Version NC_000913.3 GI:556503834
atgatccccttacaacatggactgatcctcgcggcaatcttattcgttcttggcttaacc
ggtctggttatccgtcgcaatctgctgtttatgttgattggtctggaaatcatgattaac
gcctccgcgctggccttcgtggtcgccggaagctactggggccagaccgacggtcaggtg
atgtacattctcgccatcagcctcgcggcggcagaagcgagtatcggccttgcgctgctg
ctgcaacttcaccgtcgtcgccagaacctgaacatcgattcagtaagtgagatgcgcgga
tga
              
                            

Download fasta file
RegulonDB