RegulonDB RegulonDB 10.9: Gene Sequence
nuoL gene sequence


Size: 1842        A: 308  T: 481  G: 546  C: 507

Fasta

 

>nuoL E. coli K12. Version NC_000913.3 GI:556503834
atgaacatgcttgccttaaccattattttgccattgattggcttcgtcctgctggcattc
tcccgtgggcgctggtctgaaaacgtctcggcgatcgtcggcgtaggctctgtgggcctg
gcggcgctggtaaccgcctttatcggcgttgatttcttcgctaacggcgagcagacatac
agccagccgctgtggacgtggatgtcggtaggcgactttaacatcggttttaacctggtg
ctggacggcctgtcgctgaccatgctctcggtggtcactggtgtgggtttccttattcac
atgtacgcctcctggtatatgcgcggtgaagagggctactctcgcttcttcgcttacacc
aacctgttcatcgccagcatggtggttctggtgcttgccgacaacctgctgctgatgtac
ctcggctgggaaggcgtgggcctgtgctcctatctgctgatcgggttctattacaccgat
ccgaagaatggcgcagcggcaatgaaagcgttcgtcgtgacccgtgtgggtgacgtgttc
ctcgctttcgcactgttcattctttacaacgaactgggcaccctgaacttccgcgaaatg
gtggaactggcaccagcgcactttgctgacggcaataacatgctgatgtgggcgacgctg
atgctgctgggcggtgcggtcggtaaatctgcgcagttgccgttgcagacatggcttgcc
gacgcgatggcgggcccgacgcctgtctccgcgctgatccacgccgcaaccatggtaacc
gcgggtgtctacctgatcgcccgtacccacggcctgttcctgatgacgccggaagttctg
catctggtgggtattgtcggggcggttacgctgctgctggccggttttgccgcgctggta
cagaccgacatcaaacgtgttctcgcttactctaccatgagccagattggctacatgttc
ctcgcgcttggcgtgcaggcatgggatgcggcgattttccacttgatgacccacgcgttc
tttaaagcgctgctgttcctggcatccggttccgtcattctggcctgccatcacgaacag
aacatcttcaagatgggcggtctgcgtaaatctattccgctggtttatctctgcttcctg
gtgggcggcgcagcactgtcggcactaccgctggtcactgcgggcttcttcagtaaggat
gagatcctcgcgggtgcgatggcgaatggtcatatcaatctgatggtggcaggtctggtc
ggtgcgtttatgacctcgctctacaccttccgtatgattttcatcgtcttccacggaaaa
gaacaaattcacgctcacgccgtgaaaggggtaactcacagcctgccgctgattgtgctg
ctgatcctttccaccttcgttggcgcactgattgtaccgccgctgcagggcgtgcttccg
caaacgacggaactggcgcacggcagcatgttgaccctggaaattacctctggcgtggtc
gcggtggtcggcattctgctggcagcctggctgtggctgggtaaacgtactctggtgacc
tccatcgccaacagtgcgccgggccgtctgctgggcacctggtggtacaacgcctgggga
tttgactggctgtatgacaaagtgttcgtcaagccgttcctgggtattgcctggttgctg
aaacgcgatccgctgaactcaatgatgaacatcccggctgtcctttcccgctttgcaggt
aaaggtctgctgttaagtgagaacggctatctgcgctggtatgtggcatccatgagcatc
ggtgcggtcgtggtgctggcactgttgatggtactgcgttga
              
                            

Download fasta file
RegulonDB