RegulonDB RegulonDB 10.9: Gene Sequence
sgrR gene sequence


Size: 1656        A: 383  T: 364  G: 447  C: 462

Fasta

 

>sgrR E. coli K12. Version NC_000913.3 GI:556503834
atgccatctgctcgtctgcaacaacagttcatccgcctgtggcaatgctgcgagggtaaa
tcgcaggacacaacgctcaacgaactggcagcgttattgagctgctcgcgtcgtcatatg
cgcaccctgctcaacaccatgcaggatcgcggctggctgacgtgggaagcggaagtcggg
cgcggtaaacgctcgcgtctgacattcctctataccgggctggcgcttcagcaacagcgg
gcggaagacctgctggagcaggatcgtatcgatcaactggtgcagttggttggcgacaaa
gcgactgtgcggcaaatgctggtttctcatctgggccgcagcttccgccaggggcggcac
atcctgcgcgtgctctactatcgtccgttgcgtaatctgctacctggcagcgcattgcgc
cgttccgaaacccatatcgcccggcaaatcttcagttcgctaacgcgcataaatgaggaa
aatggggaactggaagcagacatcgcccaccactggcagcaaatttcaccgcttcactgg
cgtttctttttgcgtccaggagtccattttcaccatggtcgtgaactggaaatggacgat
gtgatcgcctctttaaaacgaatcaatacgctgccgctctattcgcatattgctgacatt
gtgtcgccgacgccctggacgctggatatccatctcacgcaaccggaccgctggttaccg
ttactgctggggcaagttccggcgatgatcctgccgcgcgaatgggaaaccctcagtaac
tttgccagccatcccatcggcaccggtccgtatgcggtgattcgcaacagcaccaatcaa
ctgaaaattcaggcattcgatgacttcttcggttaccgggcattaatcgacgaagttaac
gtctgggttctgccggaaattgccgacgagccagccggagggctgatgctaaaaggtcca
cagggcgaggaaaaagagattgaaagccgcctggaggaaggttgctactatttactgttc
gacagccgcacccatcgcggggcgaatcagcaagtcagggactgggtaagctatgtgctt
tctccaactaatctggtctatttcgctgaggaacagtaccagcaactgtggttcccggct
tatggactgctcccccgttggcaccatgcccgcaccataaagagcgaaaaaccggctggc
ctggaaagcctcaccctaaccttttatcaggatcacagtgagcatcgggtgattgccggg
atcatgcagcagattctggcaagtcaccaggtcacgctgaaaatcaaagagatcgactac
gatcagtggcatacaggagagatcgaaagtgatatctggctaaacagcgccaactttacc
ctgccgctggacttctctgttttcgcacatttatgcgaagtgccactgctacaacattgc
attcccattgactggcaagccgacgctgctcgctggcgcaatggcgagatgaatctggcg
aactggtgccagcaactggtcgccagcaaagcgatggtgccattattgcaccactggctg
atcattcaggggcaacgcagtatgcgcggcctgcgcatgaataccctcggctggttcgat
tttaaatcagcgtggtttgcgccaccggatccatga
              
                            

Download fasta file
RegulonDB