RegulonDB RegulonDB 10.9: Gene Sequence
pgeF gene sequence


Size: 732        A: 150  T: 181  G: 220  C: 181

Fasta

 

>pgeF E. coli K12. Version NC_000913.3 GI:556503834
atgagtaagctgattgtcccgcagtggccgcagccaaaaggtgttgcggcctgtagctcc
actcgtatcggcggcgtgagcttgcccccgtatgactcactcaacctcggtgcccattgt
ggcgataacccggatcacgttgaggagaatcgcaagcgactttttgctgcgggcaatttg
ccttctaaaccggtctggcttgagcaggtacacggcaaagatgtgcttaagctcactggc
gaaccttatgcctcaaaacgggcggatgcctcttatagcaatacgcccggcacggtttgc
gcagtgatgactgccgactgcctccctgtgctgttttgcaatcgagcgggaacggaagtc
gccgccgctcatgctggctggcgtggactgtgcgcaggcgtgctggaagagacggtttcc
tgttttgctgataatccggaaaatattctcgcctggttagggccggcaattggtccacgc
gcgttcgaagtggggggggaggttcgcgaggcgtttatggcagtagacgctaaagcaagt
gcagctttcattcagcatggtgataagtatctggcggatatttatcagcttgcccggcag
cgtctggcgaacgtgggtgttgagcaaattttcggcggcgaccgttgtacatatacggaa
aatgagactttcttctcttatcgtcgcgacaagaccaccggtcgtatggcaagtttcatt
tggctgatataa
              
                            

Download fasta file
RegulonDB