RegulonDB RegulonDB 10.9: Gene Sequence
rluD gene sequence


Size: 981        A: 242  T: 221  G: 271  C: 247

Fasta

 

>rluD E. coli K12. Version NC_000913.3 GI:556503834
atggcacaacgagtacagctcactgcaacggtgtccgaaaaccaactcggtcaacgctta
gatcaggctttggccgaaatgttcccggattattcacgttcgcgaataaaagaatggatc
ctcgaccagcgagtgctggttaacggcaaagtttgtgataagccgaaagaaaaagtattg
ggtggcgagcaggttgccatcaacgctgagattgaagaagaagcgcgttttgaaccgcag
gatatcccgctggatatcgtctatgaagatgaagacattattatcattaataaaccgcgc
gacctggtggtacatcctggcgcgggtaacccggatggcacggtactgaatgcgttgctt
cattactatccacccattgccgatgtaccgcgtgcgggcatcgtccatcgtctggataaa
gacaccactggcctgatggttgtggcaaaaaccgttccggctcagacgcgtttagtcgaa
tctttgcaacggcgtgaaattactcgtgagtatgaagcggtggcgattggtcatatgacc
gcaggtggcacggtggacgagccaatcagtcgccacccgaccaaacgtacccatatggcg
gtgcatccgatgggcaaaccagcggtgactcactatcgcatcatggaacacttccgtgtg
cacacgcgtctgcggttgcgtctggaaactggacgtacgcaccagatccgcgtgcatatg
gcccatatcactcatccgctggtgggcgatccggtttatggtggccgtccgcgtccgcca
aaaggtgcttcggaagcatttatctccacgctgcgtaagtttgaccgccaggcgctacat
gcaaccatgctgcgtctttatcacccgatctccggcatcgaaatggaatggcatgcgcct
attccacaagatatggtggagctgattgaggtgatgcgcgccgatttcgaagaacataag
gatgaagtggactggttatga
              
                            

Download fasta file
RegulonDB