RegulonDB RegulonDB 10.9: Gene Sequence
tktB gene sequence


Size: 2004        A: 485  T: 424  G: 595  C: 500

Fasta

 

>tktB E. coli K12. Version NC_000913.3 GI:556503834
atgtcccgaaaagaccttgccaatgcgattcgcgcactcagtatggatgcggtacaaaaa
gccaactctggtcatcccggcgcgccgatgggcatggctgatattgccgaagtgctgtgg
aacgattttcttaaacataaccctaccgacccaacctggtatgatcgcgaccgctttatt
ctttccaacggtcacgcgtcgatgctgctctacagtttgctacatctgaccggttacgac
ctgccgctggaagaactgaagaacttccgtcagttgcattcgaaaaccccaggccacccg
gagattggctatacgccaggcgttgaaaccaccaccggcccgcttggacaaggtttggcg
aacgccgtcgggctggcgatagcagagcgtacactggcggcgcagtttaaccagccagac
catgagatcgtcgatcacttcacctatgtgtttatgggcgacggctgcctgatggaaggt
atttcccacgaagtctgttcgctggcaggcacgctgggactgggcaagctgattggtttt
tacgatcacaacggtatttccatcgacggtgaaacagaaggctggtttaccgacgatacg
gcaaaacgttttgaagcctatcactggcatgtgatccatgaaatcgacggtcacgatccg
caggcggtgaaggaagcgatccttgaagcgcaaagcgtgaaagataagccgtcgctgatt
atctgccgtacggtgattggctttggttcgccgaataaagcaggtaaggaagaggcgcac
ggcgcaccactgggggaagaagaagtggcgctggcacggcaaaaactgggctggcaccat
ccgccatttgagatccctaaagagatttatcacgcctgggatgcccgtgaaaaaggcgaa
aaagcgcagcagagctggaatgagaagtttgccgcctataaaaaggctcatccgcaactg
gcagaagagtttacccgacggatgagcggtggtttaccgaaggactgggagaaaacgact
cagaaatatatcaatgagttacaggcaaatccggcgaaaatcgctacccgtaaggcttcg
caaaatacgcttaacgcttacgggccgatgctgcctgagttgctcggcggttcggcggat
ctggctcccagcaacctgaccatctggaaaggttctgtttcgctgaaggaagatccagcg
ggcaactacattcactacggggtgcgtgaatttggcatgaccgctatcgccaacggcatc
gcgcaccacggcggctttgtgccgtataccgcgacgttcctgatgtttgttgaatacgcc
cgtaacgccgcgcggatggcggcactgatgaaagcgcggcagattatggtttatacccac
gactcaattggcctgggcgaagatggtccgacgcaccaggctgttgagcaactggccagc
ctgcgcttaacgccaaatttcagcacctggcgaccgtgcgatcaggtggaagcggcggtg
ggctggaagctggcggttgagcgccacaacggaccgacggcactgatcctctcaaggcag
aatctggcccaggtggaacgtacgccggatcaggttaaagagattgctcgtggcggttat
gtgctgaaagacagcggcggtaagccagatattattctgattgccaccggttcagagatg
gaaattaccctgcaagcggcagagaaattagcaggagaaggtcgcaatgtacgcgtagtt
tccctgccctcgaccgatattttcgacgcccaggatgaggaatatcgggagtcggtgttg
ccttctaacgttgcggctcgcgtggcggtggaagcaggtattgccgattactggtacaag
tatgttggtctgaaaggggcaattgtcgggatgacgggttacggggaatctgctccggcg
gataagctgttcccgttctttggctttaccgccgagaatattgtggcaaaagcgcataag
gtgctgggagtgaaaggtgcctga
              
                            

Download fasta file
RegulonDB