RegulonDB RegulonDB 10.10: Gene Sequence
feoB gene sequence


Size: 2322        A: 482  T: 569  G: 646  C: 625

Fasta

 

>feoB E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaattaaccattggcttaattggtaatccaaattctggcaagacaacgttattt
aaccagctcactggctcacgtcagcgtgtaggtaactgggctggcgttaccgtcgaacgt
aaagaagggcaattctccaccaccgatcatcaggtcacgctggtggacctgcccggcacc
tattctctgaccaccatctcatcgcagacctcgctcgatgagcaaatcgcctgtcactac
attttgagtggcgacgccgacctgctgattaacgtggtggatgcgtctaaccttgagcgt
aacctgtacctgacgctacaactgctggaactcggcattccctgcattgtggcactgaac
atgctcgacattgccgagaagcaaaatattcgtattgaaattgatgctctgtcggcgcgt
ctgggctgtccggtgatcccgctggtttcaacccgtggtcgcggtattgaagcgctcaag
ctggcgattgatcgctataaagctaacgagaatgtggaactggtgcattacgcacagccg
ctgctcaacgaagcagattcactggcaaaagtgatgccttccgacatcccgctgaaacaa
cgtcgctggctgggcctgcaaatgctggaaggcgatatctacagccgcgcctacgccggt
gaagcgtcgcagcatctggatgccgccctcgcccgtctgcgtaatgagatggacgatccg
gcgctgcacattgccgatgcgcgttaccagtgcattgctgccatctgtgatgtggtaagc
aacaccctgacggcagaacccagccgtttcaccactgcggtagataaaatcgtgctcaac
cgtttcctcggtctgccgattttcctctttgtgatgtacctgatgttcctgctggctatc
aacatcggcggggcgttacagccgctgtttgacgtcggctccgtggcgctatttgtgcat
ggtattcaatggattggctacacgctccacttcccggactggctgactatcttcctcgcc
cagggcctgggtggcggcattaacaccgtgctgccactggtgccgcagattggcatgatg
tacctgttcctctccttccttgaggactccgggtatatggcgcgtgcggcgtttgtgatg
gaccgtctgatgcaggcgctgggcttgccggggaaatcctttgtgccgctgatcgtcggt
ttcggttgtaacgtaccgtcggtaatgggtgcacgtacgcttgatgcaccgcgtgaacgt
ctgatgaccatcatgatggcaccgtttatgtcctgcggcgcgcgtctggctatcttcgca
gtattcgcggctgccttcttcgggcagaacggtgcgctggcggtcttctcgctgtatatg
ctgggtattgtgatggcggtgctgactggcctgatgctcaagtacaccatcatgcgcggt
gaagcgacgccgtttgtcatggagttgccggtctatcatgtaccacacgttaaaagcctg
attatccagacctggcagcgtctgaaaggcttcgttctgcgtgctggtaaagtgatcatc
atcgtcagcattttcctgagcgctttcaacagcttctcgctgagcgggaaaatcgtcgat
aacatcaacgactcggcgctggcgtccgtcagccgggtgatcaccccggtcttcaagcca
attggcgtgcatgaagataactggcaggcaacggttggcctgtttacaggtgccatggcg
aaagaagtggtagtgggtacgctcaacaccctctacaccgcagaaaatattcaggacgaa
gagttcaatccggcagaatttaacctcggtgaagagctgttcagtgcgatagatgaaacc
tggcagagcctgaaagacaccttcagccttagcgtactgatgaaccccattgaagccagc
aaaggcgacggcgaaatgggtaccggggcgatgggcgtgatggatcagaaattcggtagc
gcagcagcagcttacagctacctgattttcgtcctgctgtatgtaccatgtatctcggtg
atgggggctatcgcccgtgaatcaagccgtggctggatgggcttctccatcctgtggggg
ctgaatatcgcttactcactggcaacattgttctatcaggtcgccagctacagtcagcat
ccaacttacagcctggtgtgcattctggcggttatcctgtttaacatcgtggttatcggt
ctgctgcgccgcgcgcgtagccgggtggatatcgaactgctggcaacccgcaagtcggta
agcagttgctgcgcagccagcaccaccggtgattgccattaa
              
                            

Download fasta file
RegulonDB