RegulonDB RegulonDB 10.9: Gene Sequence
yeiR gene sequence


Size: 987        A: 238  T: 211  G: 280  C: 258

Fasta

 

>yeiR E. coli K12. Version NC_000913.3 GI:556503834
gtgaccaggaccaacctcatcaccggttttctcggcagcgggaaaaccacgtcgattctt
catctgttagcccataaagatcccaacgaaaaatgggcggtactggttaatgaatttggg
gaagtcggaattgatggtgctttgctcgccgatagcggcgcattgctgaaagagatcccc
ggcggctgcatgtgctgcgttaatggtttacccatgcaggtagggttgaataccttactg
cgtcagggaaaaccagaccgcttgttgatagagccgaccgggctgggccatccgaaacag
atcctcgatctgttaaccgcaccagtctatgaaccgtggatagatctgcgcgccaccttg
tgcattctcgatccgcgcttgctgctggacgaaaaaagcgccagcaatgaaaacttccgt
gaccagctggctgccgcagacatcattgtcgccaataaatccgaccgtacgacgcccgaa
agtgagcaagcgctacagcgttggtggcagcaaaatggtggcgatcgacaattaattcac
agtgagcatgggaaagttgacggtcatcttctggatttgccgcgtcgcaatttagccgag
ttgcccgccagcgccgcgcattctcatcagcatgtcgtgaaaaaagggttagcagcgtta
agcctgccagagcatcaacgctggcgtcgcagtctgaacagcgggcaaggatatcaggcc
tgcggctggatattcgacgctgatacggtattcgacaccattggcattctggaatgggcg
cgacttgcaccggtggaacgcgtcaaaggcgtgctgcgtattcccgaagggctggtgcga
atcaaccgtcagggcgatgacctgcacattgaaacgcaaaacgttgcgccaccggacagc
cgtattgagctgatttccagcagcgaagctgactggaatgccttgcagagcgcgctgttg
aagcttcgtttagcgactaccgcgtaa
              
                            

Download fasta file
RegulonDB