RegulonDB RegulonDB 10.10: Gene Sequence
yeiE gene sequence


Size: 882        A: 188  T: 220  G: 259  C: 215

Fasta

 

>yeiE E. coli K12. Version NC_000913.3 GI:556503834
atgcacatcaccctccggcagttggaagtttttgcagaagtattgaaaagtggatcaacc
acccaggcgtcggtgatgctggcgttgtcgcaatcagcagtgagcgcagccttgaccgac
ctggaagggcagcttggcgtgcaactgtttgatcgcgtggggaaaagactggttgttaat
gaacacgggcggctgctctatccgcgtgcgttggcattgcttgaacaggcggttgaaatc
gaacaactgtttcgcgaagacaacggcgcgattcgtatctatgccagtagtaccatcggt
aactacattctgcctgcagttatcgcccgttatcgccatgattatccgcagttgccgatt
gaacttagcgttgggaatagccaggacgtgatgcaagcggtgctggatttccgcgttgat
attggctttattgaaggaccgtgccacagcactgaaatcatttctgaaccgtggctggaa
gacgagctggtggttttcgccgcgccgacttcgccgttggcccgtggtccggtcacctta
gaacagctggccgctgcgccgtggatcctgcgtgaacgcggttccggcacgcgggagatt
gtcgattatctgttgctgtcacatttaccgaagtttgagatggcgatggaattaggtaac
tccgaggcaatcaaacatgcggtgcgtcatgggttgggaattagttgcctgtcgcgacgt
gtgattgaagatcaattgcaggcaggcacattaagtgaagttgcggtccctctgccgcgc
ctgatgcgtacgttgtggcgtatacatcatcggcaaaaacacctttccaacgcgctacgg
cgctttctggactattgcgatcccgcaaatgtgccgcgttaa
              
                            

Download fasta file
RegulonDB