RegulonDB RegulonDB 10.9: Gene Sequence
hofB gene sequence


Size: 1386        A: 328  T: 317  G: 365  C: 376

Fasta

 

>hofB E. coli K12. Version NC_000913.3 GI:556503834
atgaatattccacagctcactgccctgtgtctgcgttatcatggagtcttgctggatgcc
agcgaagaggtggttcatgttgcggtagtcgatgcaccttcgcatgagctactggacgca
ttgcatttcgctaccaccaaacgtattgagatcacctgctggacgcgccaacaaatggaa
ggtcacgccagtcgcacacaacagacattgcccgtagctgttcaggagaagcatcagccc
aaagcagagttgctaactcgaacgttacaatctgcgctggaacaacgcgcgtctgatatt
catatcgaaccagcggacaatgcctaccgcatccgcttgcgtatcgacggcgtattgcat
cctttaccggatgtttcaccggatgccggagtcgcattaaccgccagattaaaagtgctg
ggaaacctggatattgcggaacatcgcctgccgcaggacgggcaattcactgtcgaactg
gcaggaaacgccgtctcatttcgtattgcgaccttaccatgtcggggtggtgaaaaggtg
gtattaaggttgttacagcaggtgggtcaggcactggatgtcaacacgcttggaatgcag
ccgttacaactggcggactttgctcatgccttgcaacaaccacagggactggtgctggta
actggccctaccggcagcggcaaaacggtcacgctttatagtgccctgcaaaagctgaat
accgctgacattaatatttgtagcgtcgaagatccagttgagatccccatagccggacta
aaccagacgcaaatccatccgcgtgccggactcacctttcagggcgttttgcgtgcgtta
ttgcgccaggatcctgacgtcatcatgatcggagagatccgcgatggcgaaacagcagag
atcgctattaaagcggcgcaaactggtcacctggtgttgtctaccctacacactaattcc
acctgcgaaacgctggtacgtttacagcaaatgggggtcgcccgctggatgctatcatcg
gcgcttacgctggtaatagcccagcgtctggtacgcaaactttgcccacattgtcgccgg
cagcaaggggagcccatccacattccagacaatgtatggccatcgccgctgccccactgg
caggcacccggttgtgtacattgctaccacggtttttatggtcgtacggccttatttgaa
gttctgcccataacgccggtcattcgtcagcttatttccgctaataccgacgttgaatcg
ctggaaacgcacgcacgacaggcgggtatgcgtacgctttttgaaaacggctgcctggcc
gtagagcaaggcttaaccacctttgaagagttaatccgcgtactggggatgccgcatggc
gagtaa
              
                            

Download fasta file
RegulonDB