RegulonDB RegulonDB 10.9: Gene Sequence
ppdD gene sequence


Size: 441        A: 107  T: 100  G: 115  C: 119

Fasta

 

>ppdD E. coli K12. Version NC_000913.3 GI:556503834
atggacaagcaacgcggttttacacttatcgaactgatggtggttattggcatcattgcc
attttaagcgccattggtattcccgcttatcaaaactacctgcgcaaagccgcactcacc
gacatgctacaaacctttgtgccttaccgtaccgccgtagagttgtgcgcgctggaacat
ggtggattagatacctgcgacggtggcagcaatggcattccctcgcctaccaccacccgc
tatgtttcagccatgagtgtggcaaagggcgtggtgtcgctgaccgggcaagaaagtctc
aatgggctaagcgtcgtcatgacaccgggttgggataacgcaaacggcgtcaccggctgg
acgcgcaactgcaatattcaaagtgacagcgcattgcagcaagcctgcgaagatgtcttc
cgctttgatgacgccaactaa
              
                            

Download fasta file
RegulonDB