RegulonDB RegulonDB 10.9: Gene Sequence
norR gene sequence


Size: 1515        A: 303  T: 351  G: 496  C: 365

Fasta

 

>norR E. coli K12. Version NC_000913.3 GI:556503834
atgagtttttccgttgatgtgctggcgaatatcgccatcgaattgcagcgtgggattggt
caccaggatcgttttcagcgcctgatcaccacgctacgtcaggtgctggagtgcgatgcg
tctgcgttgctacgttacgattcgcggcagtttattccgcttgccatcgacggtctggca
aaggatgtactcggtagacgctttgcgctggaagggcatccacggctggaagcgattgcc
cgcgccggggatgtggtgcgctttcccgcagacagcgaattgcccgatccctatgacggt
ttgattcctgggcaggagagtctgaaggttcacgcctgcgttggtctgccattgtttgcc
gggcaaaacctgatcggcgcactgacgctcgacgggatgcagcccgatcagttcgatgtt
ttcagcgacgaagagctacggctgattgctgcgctggcggcgggagcgttaagcaatgcg
ttgctgattgaacaactggaaagccagaatatgctgccaggcgatgccacgccgtttgaa
gcggtgaaacagacgcagatgattggcttgtcccctggcatgacgcaactgaaaaaagag
attgagattgtggcggcgtccgatctcaacgtcctgatcagcggtgagactggaaccggt
aaggagctggtggcgaaagcgattcatgaagcctcgccacgggcggtgaatccgctggtc
tatctcaactgtgctgcactgccggaaagtgtggcggaaagtgagttgttcgggcatgtg
aaaggagcgtttactggcgctatcagtaatcgcagcgggaagtttgaaatggcggataac
ggcacgctgtttctggatgagatcggcgagttgtcgttggcattgcaggccaagctgctg
agggtgttgcagtatggcgatattcagcgcgttggcgatgaccgttgtttgcgggtcgat
gtgcgcgtgctggcggcgactaaccgcgatttacgcgaagaggtgctggcagggcgattc
cgcgccgatttgtttcatcgcctgagcgtgtttccactttcggtgccgccgctgcgtgag
cggggcgatgatgtcattctgctggcggggtatttctgcgagcagtgtcgtttgcggcag
gggctctcccgcgtggtattaagtgccggagcgcgaaatttactgcaacactacagtttt
ccgggaaacgtgcgcgaactggaacatgctattcatcgggcggtagttctggcgagagcc
acccgcagcggcgatgaagtgattcttgaggcgcaacattttgcttttcctgaggtgacg
ttgccgacgccagaagtggcggcggtgcccgttgttaagcaaaacctgcgtgaagcgaca
gaagcgttccagcgtgaaactattcgtcaggcactggcacaaaatcatcacaactgggct
gcctgcgcgcggatgctggaaaccgacgtcgccaacctgcatcggctggcgaaacgtctg
ggattgaaggattaa
              
                            

Download fasta file
RegulonDB