RegulonDB RegulonDB 10.9: Gene Sequence
ompX gene sequence


Size: 516        A: 130  T: 121  G: 130  C: 135

Fasta

 

>ompX E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaaattgcatgtctttcagcactggccgcagttctggctttcaccgcaggtact
tccgtagctgcgacttctactgtaactggcggttacgcacagagcgacgctcagggccaa
atgaacaaaatgggcggtttcaacctgaaataccgctatgaagaagacaacagcccgctg
ggtgtgatcggttctttcacttacaccgagaaaagccgtactgcaagctctggtgactac
aacaaaaaccagtactacggcatcactgctggtccggcttaccgcattaacgactgggca
agcatctacggtgtagtgggtgtgggttatggtaaattccagaccactgaatacccgacc
tacaaacacgacaccagcgactacggtttctcctacggtgcgggtctgcagttcaacccg
atggaaaacgttgctctggacttctcttacgagcagagccgtattcgtagcgttgacgta
ggcacctggattgccggtgttggttaccgcttctaa
              
                            

Download fasta file
RegulonDB