RegulonDB RegulonDB 10.9: Gene Sequence
ychJ gene sequence


Size: 459        A: 110  T: 136  G: 120  C: 93

Fasta

 

>ychJ E. coli K12. Version NC_000913.3 GI:556503834
gtgtctcagctttgtccctgtggtagtgctgtcgagtatagcctatgttgccacccttat
gtgtctggtgaaaaggttgcacctgatccagaacatctcatgcgttcgcgttactgcgct
tttgtgatgcaagacgcagattatttaataaagacctggcatccctcttgtggagcagcg
gcgttacgtgccgaattgatggccggatttgcgcatactgaatggttgggattgaccgta
tttgaacattgttggcaggacgccgacaatatcggatttgtcagttttgttgctcgattt
accgaaggtggtaaaacaggtgcaataattgaacgttcgcgatttttgaaagaaaacggt
caatggtactatattgacggtacacgtccgcagtttggtcgcaacgatccctgcccttgt
ggttcaggtaaaaaatttaaaaagtgctgcggccaataa
              
                            

Download fasta file
RegulonDB