RegulonDB RegulonDB 10.9: Gene Sequence
rssB gene sequence


Size: 1014        A: 243  T: 278  G: 272  C: 221

Fasta

 

>rssB E. coli K12. Version NC_000913.3 GI:556503834
atgacgcagccattggtcggaaaacagattctcattgttgaagatgagcaggtatttcgc
tcgcttctggattcatggttttcctcattgggagcgacaacggtactggcggctgatggg
gtggatgcccttgagttgctgggaggtttcactccagacctgatgatatgtgatatcgcg
atgccacgaatgaacgggcttaaactgctggagcatatacgtaacagaggcgaccagacc
ccagttctggtgatatctgccactgaaaatatggcagatattgccaaagcgttacgtctg
ggcgttgaagatgttttgctgaaaccagttaaagatctgaatcgcttgcgcgagatggtt
tttgcctgtctctatcccagcatgtttaattcgcgcgttgaggaagaggaaaggcttttt
cgcgactgggatgcaatggttgataaccctgccgcagcggcgaaattattacaggaacta
caaccgccggttcagcaggtgatttcccattgccgggttaattatcgtcaattggttgcc
gcggacaaacccggcctggtgcttgatattgccgcactttcggaaaacgatctggcattt
tattgccttgatgtcacccgagctggacataatggcgtacttgctgccttgttattacgc
gcattgtttaacggattattacaggaacagcttgcacaccaaaatcaacggttgccagag
ttgggcgcgttattgaagcaggtaaaccatttacttcgtcaggccaatctgccggggcag
tttccgctattagttggctattatcatcgcgaactgaaaaatctcattctggtttctgcg
ggtctgaatgcgacgttaaataccggcgaacaccaggtgcaaatcagtaatggtgttccg
ttaggcactttaggtaacgcttatttgaatcaattgagccagcgatgcgatgcctggcaa
tgccaaatatggggaaccggtggtcgactgcgcttgatgttgtctgcagaatga
              
                            

Download fasta file
RegulonDB