RegulonDB RegulonDB 10.9: Gene Sequence
hisQ gene sequence


Size: 687        A: 124  T: 202  G: 204  C: 157

Fasta

 

>hisQ E. coli K12. Version NC_000913.3 GI:556503834
atgttgtatgggttttcaggtgttattttacagggtgcgctcgtcacgctggagctggct
atcagctctgtagtgctcgctgtaatcatcggtttaattggcgctggcggtaagctctcg
caaaatcggctttcggggctgattttcgaagggtacaccacgctgattcgtggcgtgccg
gacttagtgttgatgctgctgattttctacggtttgcagattgcgctaaacacggtgacg
gaggcgatgggcgtcgggcagattgatatcgatccgatggtcgctggtattatcactctc
ggttttatctacggtgcttattttaccgaaacgttccgtggtgcttttatggcagtgccg
aaaggacatatagaggcggcgacggcgttcggttttactcgtgggcaagtgtttcggcgg
atcatgtttccgtcgatgatgcgttacgccctgccaggcattggcaacaactggcaggtg
atcctcaaatctaccgcactggtttcgttactcggcctggaagatgtggtcaaagccacc
caactggcaggcaaaagtacctgggaaccgttctatttcgccatcgtctgtggcgtgatt
tacctggttttcaccactgtttccaatggtgtgctgctgttccttgagcgccgctactcc
gtgggtgtgaagagggctgacctgtga
              
                            

Download fasta file
RegulonDB