RegulonDB RegulonDB 10.9: Gene Sequence
lgt gene sequence


Size: 876        A: 152  T: 261  G: 231  C: 232

Fasta

 

>lgt E. coli K12. Version NC_000913.3 GI:556503834
atgaccagtagctatctgcattttccggagtttgatccggtcattttctcaataggaccc
gtggcgcttcactggtacggcctgatgtatctggtgggtttcatttttgcaatgtggctg
gcaacacgacgggcgaatcgtccgggcagcggctggaccaaaaatgaagttgaaaactta
ctctatgcgggcttcctcggcgtcttcctcgggggacgtattggttatgttctgttctac
aatttcccgcagtttatggccgatccgctgtatctgttccgtgtctgggacggcggcatg
tctttccacggcggcctgattggcgttatcgtggtgatgattatcttcgcccgccgtact
aaacgttccttcttccaggtctctgattttatcgcaccactcattccgtttggtcttggt
gccgggcgtctgggcaactttattaacggtgaattgtggggccgcgttgacccgaacttc
ccgtttgccatgctgttccctggctcccgtacagaagatattttgctgctgcaaaccaac
ccgcagtggcaatccattttcgacacttacggtgtgctgccgcgccacccatcacagctt
tacgagctgctgctggaaggtgtggtgctgtttattatcctcaacctgtatattcgtaaa
ccacgcccaatgggagctgtctcaggtttgttcctgattggttacggcgcgtttcgcatc
attgttgagtttttccgccagcccgacgcgcagtttaccggtgcctgggtgcagtacatc
agcatggggcaaattctttccatcccgatgattgtcgcgggtgtgatcatgatggtctgg
gcatatcgtcgcagcccacagcaacacgtttcctga
              
                            

Download fasta file
RegulonDB