RegulonDB RegulonDB 10.9: Gene Sequence
hscA gene sequence


Size: 1851        A: 383  T: 400  G: 576  C: 492

Fasta

 

>hscA E. coli K12. Version NC_000913.3 GI:556503834
atggccttattacaaattagtgaacctggtttgagtgctgcgccgcatcagcgtcgtctg
gcggccggtattgacctgggcacaaccaactcgctggtggcgacagtgcgcagcggtcag
gccgaaacgttagccgatcatgaaggccgtcacctgctgccatctgttgttcactatcaa
cagcaagggcattcggtgggttatgacgcgcgtactaatgcagcgctcgataccgccaac
acaattagttctgttaaacgcctgatgggacgctcgctggctgatatccagcaacgctat
ccgcatctgccttatcaattccaggccagcgaaaacggcctgccgatgattgaaacggcg
gcggggctgctgaacccggtgcgcgtttctgcggacatcctcaaagcactggcggcgcgg
gcaactgaagccctggcaggcgagctggatggtgtagttatcaccgttccggcgtacttt
gacgatgcccagcgtcagggcaccaaagacgcggcgcgtctggcgggccttcacgtcctg
cgcttacttaacgaaccgaccgctgcggctatcgcctacgggctggattccggtcaggaa
ggcgtgatcgccgtttatgacctcggtggcgggacgtttgatatttccattctgcgctta
agtcgcggcgtgtttgaagtgctggcaaccggcggtgattccgcgctcggcggcgatgat
ttcgaccatctgctggcggattacattcgcgagcaggcgggcattcctgatcgtagcgat
aaccgcgttcagcgtgaactgctggatgccgccattgcagccaaaatcgcgctgagcgat
gcggactccgtgaccgttaacgttgcgggctggcagggcgaaatcagccgtgaacaattc
aatgaactgatcgcgccactggtaaaacgaaccttactggcttgtcgtcgcgcgctgaaa
gacgcgggtgtagaagctgatgaagtgctggaagtggtgatggtgggcggttctactcgc
gtgccgctggtgcgtgaacgggtaggcgaatttttcggtcgtccaccgctgacttccatc
gacccggataaagtcgtcgctattggcgcggcgattcaggcggatattctggtgggtaac
aagccagacagcgaaatgctgttgcttgatgtgatcccactgtcgctgggcctcgaaacg
atgggcggcctggtggagaaagtgattccgcgtaataccactattccggtggcccgcgct
caggatttcaccacctttaaagatggtcagacggcgatgtctatccatgtaatgcagggt
gagcgcgaactggtgcaggactgccgctcactggcgcgttttgcgctgcgtggtattccg
gcgctaccggctggcggtgcgcatattcgcgtgacgttccaggtcgatgccgacggtctt
ttgagcgtgacggcgatggagaaatccaccggcgttgaggcgtctattcaggtcaaaccg
tcttacggtctgaccgatagcgaaatcgcttcgatgatcaaagactcaatgagctatgcc
gagcaggacgtaaaagcccgaatgctggcagaacaaaaagtagaagcggcgcgtgtgctg
gaaagtctgcacggcgcgctggctgctgatgccgcgctgttaagcgccgcagaacgtcag
gtcattgacgatgctgccgctcacctgagtgaagtggcgcagggcgatgatgttgacgcc
atcgaacaagcgattaaaaacgtagacaaacaaacccaggatttcgccgctcgccgcatg
gaccagtcggttcgtcgtgcgctgaaaggccattccgtggacgaggtttaa
              
                            

Download fasta file
RegulonDB