RegulonDB RegulonDB 10.9: Gene Sequence
hscB gene sequence


Size: 516        A: 132  T: 114  G: 136  C: 134

Fasta

 

>hscB E. coli K12. Version NC_000913.3 GI:556503834
atggattacttcaccctctttggcttgcctgcccgctatcaactcgatacccaggcgctg
agcctgcgttttcaggatctacaacgtcagtatcatcctgataaattcgccagcggaagc
caggcggaacaactcgccgccgtacagcaatctgcaaccattaaccaggcctggcaaacg
ctgcgtcatccgttaatgcgcgcggaatatttgctttctttgcacggctttgatctcgcc
agcgagcagcatactgtgcgcgacaccgcgttcctgatggaacagttggagctgcgcgaa
gagctggacgagatcgaacaggcgaaagatgaagcgcggctggaaagctttatcaaacgt
gtgaaaaagatgtttgatacccgccatcagttgatggttgaacagttagacaacgagacg
tgggacgcggcggcggataccgtgcgtaagctgcgttttctcgataaactgcgaagcagt
gccgaacaactcgaagaaaaactgctcgatttttaa
              
                            

Download fasta file
RegulonDB