RegulonDB RegulonDB 10.9: Gene Sequence
ucpA gene sequence


Size: 792        A: 184  T: 170  G: 245  C: 193

Fasta

 

>ucpA E. coli K12. Version NC_000913.3 GI:556503834
atgggtaaactcacgggcaagacagcactgattacgggcgcattgcagggaattggcgaa
ggaattgccagaacttttgcacgtcatggcgcgaacctaatcttgctggatatctcccct
gagatcgaaaagctggcggacgaactgtgtggtcgtggtcatcgctgtacggcggttgtc
gccgatgtgcgtgacccggcgtcggtagccgcagctatcaaacgcgcgaaggaaaaagaa
gggcgcattgatatcctggtgaataacgcaggcgtttgtcgtctgggcagtttcctcgat
atgagcgatgacgatcgcgatttccatattgacatcaatattaaaggcgtatggaacgtc
acgaaggcggtgctgccggagatgattgcccgcaaagatggtcgcattgtgatgatgtct
tcagtcactggtgatatggtggccgatcctggcgaaacggcgtacgccttaacgaaagcg
gcgattgttggcctgacaaaatcgctggcggtggagtacgcgcagtctggtattcgcgtt
aacgccatttgcccgggatacgtgcgcacaccaatggcggaaagcattgcccgccagtcg
aacccggaagatccagagtcggtgctgactgaaatggcgaaagcaatcccgatgcgtcgc
ctcgccgatccgctggaagtcggcgaactggcggccttcctcgcatcggatgaatccagc
tatttaaccggtacacagaatgtgattgatggcggcagcacactgccggagacggttagc
gtcggtatctga
              
                            

Download fasta file
RegulonDB