RegulonDB RegulonDB 10.9: Gene Sequence
rhtA gene sequence


Size: 888        A: 158  T: 255  G: 255  C: 220

Fasta

 

>rhtA E. coli K12. Version NC_000913.3 GI:556503834
atgcctggttcattacgtaaaatgccggtctggttaccaatagtcatattgctcgttgcc
atggcgtctattcagggtggagcctcgttagctaagtcactttttcctctggtgggcgca
ccgggtgtcactgcgctgcgtctggcattaggaacgctgatcctcatcgcgttctttaag
ccatggcgactgcgctttgccaaagagcaacggttaccgctgttgttttacggcgtttcg
ctgggtgggatgaattatcttttttatctttctattcagacagtaccgctgggtattgcg
gtggcgctggagttcaccggaccactggcggtggcgctgttctcttctcgtcgcccggta
gatttcgtctgggttgtgctggcggttcttggtctgtggttcctgctaccgctggggcaa
gacgtttcccatgtcgatttaaccggctgtgcgctggcactgggggccggggcttgttgg
gctatttacattttaagtgggcaacgcgcaggagcggaacatggccctgcgacggtggca
attggttcgttgattgcagcgttaattttcgtgccaattggagcgcttcaggctggtgaa
gcactctggcactggtcggttattccattgggtctggctgtcgctattctctcgaccgct
ctgccttattcgctggaaatgattgccctcacccgtttgccaacacggacatttggtacg
ctgatgagcatggaaccggcgctggctgccgtttccgggatgattttcctcggagaaaca
ctgacacccatacagctactggcgctcggcgctatcatcgccgcttcaatggggtctacg
ctgacagtacgcaaagagagcaaaataaaagaattagacattaattaa
              
                            

Download fasta file
RegulonDB