RegulonDB RegulonDB 10.9: Gene Sequence
mdtD gene sequence


Size: 1416        A: 253  T: 377  G: 412  C: 374

Fasta

 

>mdtD E. coli K12. Version NC_000913.3 GI:556503834
atgacagatcttcccgacagcacccgttggcaattgtggattgtggctttcggcttcttt
atgcagtcgctggacaccaccatcgtaaacaccgcccttccctcaatggcgcaaagcctc
ggggaaagtccgttgcatatgcacatggtcattgtctcttatgtgctgaccgtggcggtg
atgctgcccgccagcggctggctggcggacaaagtcggcgtgcgcaatattttctttacc
gccatcgtgctgtttactctcggttcactgttttgcgcgctttccggcacgctgaacgaa
ctgttgctggcacgcgcgttacagggcgttggcggcgcgatgatggtgccggtcggcaga
ttgacggtgatgaaaatcgtaccgcgcgagcaatatatggcggcgatgacctttgtcacg
ttacccggtcaggtcggtccgctgctcggtccggcgctcggcggtctgctggtggagtac
gcatcgtggcactggatctttttgatcaacattccggtggggattatcggtgcgatcgcc
acattgctgttaatgccgaactacaccatgcagacgcggcgctttgatctctccggattt
ttattgctggcggttggcatggcggtattaaccctggcgctggacggcagtaaaggtaca
ggtttatcgccgctgacgattgcaggcctggtcgcagttggcgtggtggcactggtgctt
tatctgctgcacgccagaaataacaaccgtgccctgttcagtctgaaactgttccgtact
cgtaccttttcgctgggcctggcggggagctttgccggacgtattggcagtggcatgttg
ccctttatgacaccggttttcctgcaaattggcctcggtttctcgccgtttcatgccgga
ctgatgatgatcccgatggtgcttggcagcatgggaatgaagcgaattgtggtacaggtg
gtgaatcgctttggttatcgtcgggtactggtagcgaccacgctgggtctgtcgctggtc
accctgttgtttatgactaccgccctgctgggctggtactacgttttgccgttcgtcctg
tttttacaagggatggtcaactcgacgcgtttctcctccatgaacaccctgacgctgaaa
gatctcccggacaatctggcgagcagcggcaacagcctgctgtcgatgattatgcaattg
tcgatgagtatcggcgtcactatcgccgggctgttgctgggactttttggttcacagcat
gtcagcgtcgacagcggcaccacacaaaccgtctttatgtacacctggcttagcatggcg
ttgatcatcgcccttccggcgttcatctttgccagagtgccgaacgatacgcatcaaaat
gtagctatttcgcggcgaaaaaggagcgcgcaatga
              
                            

Download fasta file
RegulonDB