RegulonDB RegulonDB 10.9: Gene Sequence
nlpE gene sequence


Size: 711        A: 180  T: 159  G: 205  C: 167

Fasta

 

>nlpE E. coli K12. Version NC_000913.3 GI:556503834
atggtgaaaaaagcgatagtgacagcgatggctgtaatcagcctctttactctgatggga
tgtaataatcgggccgaagtcgatacgctttctccggcgcaggctgccgaactgaaaccg
atgccgcaaagttggcgcggcgtgctgccgtgtgccgattgcgaaggaatcgaaacctct
ctgttcctcgaaaaagacggaacatgggtgatgaatgagcgttatctcggtgctcgtgaa
gaaccttcctccttcgcttcctacggtacatgggcgcgaaccgctgacaagctggtatta
accgacagcaaaggtgaaaagtcatattatcgggcgaaaggcgatgcgctggagatgctc
gatcgtgaaggcaatccgattgaatcgcagttcaactatacgctggaagcggcacaatcc
agtttacctatgacgccgatgaccctgcggggcatgtatttttatatggctgatgcggcg
accttcactgattgcgcgaccggaaaacgtttcatggtagcgaataacgcagagctggag
cgtagctacctggctgcgcgcggtcacagtgaaaaaccggtgttactgtcagtagaaggt
cactttacgcttgagggtaatccggataccggtgcgccgactaaagtattggcacccgat
acggcagggaaattttaccccaaccaggattgcagtagtttggggcagtaa
              
                            

Download fasta file
RegulonDB