RegulonDB RegulonDB 10.9: Gene Sequence
yaeF gene sequence


Size: 825        A: 203  T: 215  G: 199  C: 208

Fasta

 

>yaeF E. coli K12. Version NC_000913.3 GI:556503834
atggataaaccaaaggcgtactgccgcctgtttctccccagctttcttttactttcggct
tgtaccgttgatatcagccagccagacccatcagccacagcagtagatgccgaggcaaaa
acatgggctgtcaaattccagcatcaaagctctttcaccgaacaatcaataaaagaaata
acggcacctgatctcaaacccggcgatttgctgttctcctcaagccttggggtaacctca
tttggaatccgcgtcttcagcacttcctctgtgagtcacgttgcaatctttctgggtgat
aataacgttgcagaagcgacaggcgctggcgtccagatcgtttcccttaaaaaagcgatg
aagcatagtgataagcttttcgtcttacgagtcccggatcttaccccgcaacaagccaca
gatatcaccgcgtttgccaataaaatcaaagatagcggttataactatcgcggcattgtc
gaatttattccctttatggtgactcgccagatgtgctcactgaatccgttctccgaggat
tttcgccaacagtgcgtcagcggcctggcgaaagcgcagttaagcagtgtgggcgaagga
gacaaaaagtcgtggttttgttcggaatttgtcacggatgcctttgccaaagccgggcat
ccacttacactggcgcaatcgggctggattagccctgccgatctgatgcatatgcgtatt
ggtgatgtctctgcgtttaagccagaaacgcagttacagtatgttgggcacctgaagcct
gggatttatatcaaggcgggtcgctttgttggtttgacccggtga
              
                            

Download fasta file
RegulonDB