RegulonDB RegulonDB 10.9: Gene Sequence
sdaC gene sequence


Size: 1290        A: 277  T: 338  G: 330  C: 345

Fasta

 

>sdaC E. coli K12. Version NC_000913.3 GI:556503834
atggaaacgactcaaaccagcacgattgcgtcgaaagactctcgtagtgcctggcgcaag
acagacaccatgtggatgctgggcctttacggcacggcaatcggcgcgggcgtgctgttc
ctgccaatcaacgccggtgttggcggtatgatcccgctgatcatcatggctatccttgcg
ttcccgatgacgttttttgctcaccgcggcctgactcgcttcgtactgtctggtaaaaac
ccgggcgaagacatcaccgaggttgtagaagaacactttggtattggcgcaggtaaactg
attaccctgctctacttcttcgctatctacccgatcctgctggtttatagcgtggcaatc
accaataccgttgaaagcttcatgtctcaccagctgggtatgacgccaccgccgcgtgcg
attctgtcgctgatcctgatcgtgggtatgatgaccatcgttcgcttcggtgagcagatg
atcgttaaagcgatgagtattctggtattcccgtttgttggcgtactgatgctgctggct
ctgtacctgatcccgcagtggaacggcgctgcactggaaacgctgtctctggacactgca
tctgcaaccggaaacggtctgtggatgaccctgtggctggcaattccggtaatggtgttc
tcgttcaaccactctccgatcatctcttctttcgccgttgcgaagcgtgaagagtacggc
gatatggcagaacagaaatgctcgaagatcctggcattcgcacacatcatgatggtgctg
accgtaatgttcttcgtcttcagctgtgtactgagcctgactccggcagacctggctgcg
gctaaagagcagaacatctcgattctgtcttacctggctaaccactttaacgcaccggtt
atcgcgtggatggctccgattatcgcgattatcgctatcaccaaatccttcctcggtcac
tacctgggcgcacgtgaaggcttcaacggtatggtgattaaatctctgcgtggtaaaggt
aagtctatcgaaatcaacaagctgaaccgtatcactgcgctgttcatgctggtaacgacc
tggattgttgccaccctgaacccgagcatcctgggtatgattgaaaccctgggcggtcca
atcatcgcgatgatcctgttcctgatgccgatgtacgcaattcagaaagtaccggcaatg
cgtaagtacagcggtcacatcagcaacgtattcgttgtcgtgatgggtctgattgcaatc
tccgcaatcttctactctctgttcagctaa
              
                            

Download fasta file
RegulonDB