RegulonDB RegulonDB 11.1: Gene Sequence
pgm gene sequence


Size: 1641        A: 386  T: 348  G: 473  C: 434

Fasta

 

>pgm E. coli K12. Version NC_000913.3 GI:556503834
atggcaatccacaatcgtgcaggccaacctgcacaacagagtgatttgattaacgtcgcc
caactgacggcgcaatattatgtactgaaaccagaagcagggaatgcggagcacgcggtg
aaattcggtacttccggtcaccgtggcagtgcagcgcgccacagctttaacgagccgcac
attctggcgatcgctcaggcaattgctgaagaacgtgcgaaaaacggcatcactggccct
tgctatgtgggtaaagatactcacgccctgtccgaacctgcattcatttccgttctggaa
gtgctggcagcgaacggcgttgatgtcattgtgcaggaaaacaatggcttcaccccgacg
cctgccgtttccaatgccatcctggttcacaataaaaaaggtggcccgctggcagacggt
atcgtgattacaccgtcccataacccgccggaagatggtggaatcaaatacaatccgcca
aatggtggcccggctgataccaacgtcactaaagtggtggaagacagggccaacgcactg
ctggccgatggcctgaaaggcgtgaagcgtatctccctcgacgaagcgatggcatccggt
catgtgaaagagcaggatctggtgcagccgttcgtggaaggtctggccgatatcgttgat
atggccgcgattcagaaagcgggcctgacgctgggcgttgatccgctgggcggttccggt
atcgaatactggaagcgtattggcgagtattacaacctcaacctgactatcgttaacgat
caggtcgatcaaaccttccgctttatgcaccttgataaagacggcgcgatccgtatggac
tgctcctccgagtgtgcgatggcgggcctgctggcactgcgtgataagttcgatctggcg
tttgctaacgacccggattatgaccgtcacggtatcgtcactccggcaggtttgatgaat
ccgaaccactacctggcggtggcaatcaattacctgttccagcatcgtccgcagtggggc
aaagatgttgccgtcggtaaaacgctggtttcatctgcgatgatcgaccgtgtggtcaac
gacttgggccgtaaactggtagaagtcccggtaggtttcaaatggtttgtcgatggtctg
ttcgacggcagcttcggctttggcggcgaagagagtgcaggggcttccttcctgcgtttc
gacggcacgccgtggtccaccgacaaagacggcatcatcatgtgtctgctggcggcggaa
atcaccgctgtcaccggtaagaacccgcaggaacactacaacgaactggcaaaacgcttt
ggtgcgccgagctacaaccgtttgcaggcagctgcgacttccgcacaaaaagcggcgctg
tctaagctgtctccggaaatggtgagcgccagcaccctggcaggtgacccgatcaccgcg
cgcctgactgctgctccgggcaacggtgcttctattggcggtctgaaagtgatgactgac
aacggctggttcgccgcgcgtccgtcaggcacggaagacgcatataagatctactgcgaa
agcttcctcggtgaagaacatcgcaagcagattgagaaagaagcggttgagattgttagc
gaagttctgaaaaacgcgtaa
              
                            

Download fasta file
RegulonDB