RegulonDB RegulonDB 11.0: Gene Sequence
rapZ gene sequence


Size: 855        A: 198  T: 211  G: 213  C: 233

Fasta

 

>rapZ E. coli K12. Version NC_000913.3 GI:556503834
atggtactgatgatcgtcagcggacgttcaggttcaggtaaatctgtcgccctgcgtgcg
ctggaagatatgggtttttactgcgtggataaccttcccgtagtgttgttacccgatctg
gctcgaaccctggccgatcgcgagatttctgccgccgtcagcattgatgttcgtaatatg
ccggagtcaccagaaatattcgaacaggcgatgagtaacctgcctgacgctttctcaccg
caactcctgttcctggatgccgaccgtaataccttaattcgtcgttacagtgacacgcgc
cgactgcatccgctttccagcaaaaacctgtcgctggaaagtgctatcgacaaagaaagc
gatttgctggagcctctgcgttcgcgagcggatctgattgtcgatacctcagaaatgtcc
gttcacgagctggctgaaatgctgcgtacccgtctgctgggtaaacgtgaacgcgaactg
accatggtctttgagtctttcggcttcaaacacggtatccctatcgatgcagattacgtc
tttgacgtgcgcttcttgccgaacccgcactgggatccgaaactgcgtccaatgacaggt
cttgataaacctgtcgccgcgttcctcgaccgccacacagaagtacacaattttatctac
cagacgcgaagctatcttgagctatggttacctatgctggaaaccaacaaccgtagctac
ttgacggtcgccattggttgtaccggcgggaagcaccgttcggtgtatattgcagagcaa
ctggcagactacttccgctcgcgcggtaaaaacgtccagtcacgccatcgtacgctggaa
aaacgtaaaccatga
              
                            

Download fasta file
RegulonDB