RegulonDB RegulonDB 10.10: Gene Sequence
npr gene sequence


Size: 273        A: 74  T: 65  G: 75  C: 59

Fasta

 

>npr E. coli K12. Version NC_000913.3 GI:556503834
atgaccgtcaagcaaactgttgaaatcacaaacaagctgggcatgcatgcccggcctgca
atgaagctgtttgaattaatgcagggttttgacgctgaagtgctcttacgtaatgacgaa
ggcaccgaggctgaagccaacagcgttattgcgctgctgatgttggattctgccaaagga
cggcagattgaagttgaagcgaccggtccacaggaagaggaagcactggccgccgttatc
gccctctttaattctggttttgatgaagattaa
              
                            

Download fasta file
RegulonDB