RegulonDB RegulonDB 10.9: Gene Sequence
cobT gene sequence


Size: 1080        A: 257  T: 269  G: 313  C: 241

Fasta

 

>cobT E. coli K12. Version NC_000913.3 GI:556503834
atgcaaatacttgccgatttactgaatacgatcccagccatcgattctaccgctatgtcg
cgtgcacaacggcatattgacgggttactcaaacctgttggtagcctgggaaagctggag
gtgcttgccatacaactggcaggaatgccggggttgaatggcataccgcatgtgggcaaa
aaagcggtactggttatgtgtgccgatcacggcgtctgggaggaaggggtcgctatttct
ccaaaagaagtgacagccatacaggctgaaaatatgacccgtggaacaaccggcgtgtgt
gtgctggcagaacaagcgggcgctaacgtccacgtaattgatgttggtattgatactgct
gagcctatccccgggcttatcaacatgcgtgtcgcacgaggtagcggcaatattgcttca
gctccggcaatgagtcgccgtcaggctgaaaagttgcttttggacgtcatatgttatacg
caggagctggcaaaaaacggtgtcacgctgtttggtgtaggtgaactggggatggcaaac
acgacaccggcagcagcaatagtcagcacaatcactggccgggatcctgaagaagtggtt
gggattggcgcaaacctgccgacagataaactggctaataaaattgatgttgtgcgtcgg
gcgattacgttgaatcaaccaaatcctcaggatggtgttgatgtcctggcaaaagtgggt
ggatttgatttggtcggaatagctggagtgatgttaggtgctgcttcctgcggtttaccc
gtgttgctggatggatttctttcttatgctgctgcgctcgcagcctgccagatgtctcct
gcgatcaaaccgtatctcattccttctcacctgtcggcagaaaaaggcgcgcgtatagcg
ctctcgcatttggggctggagccttatctcaatatggagatgcgtttaggtgaggggagt
ggcgcagctctggcgatgcccatcatcgaagctgcctgtgcgatatacaacaacatgggc
gaacttgctgccagtaatattgttctaccggggaatacgacttctgatttgaacagttaa
              
                            

Download fasta file
RegulonDB