RegulonDB RegulonDB 10.9: Gene Sequence
idnK gene sequence


Size: 564        A: 164  T: 155  G: 139  C: 106

Fasta

 

>idnK E. coli K12. Version NC_000913.3 GI:556503834
atggcgggtgaaagctttattttgatgggcgtttcagggagtggtaaaacattaattggt
agcaaggttgccgcgttattatctgctaaatttattgatggtgacgatcttcatccagcc
aaaaatatagataaaatgtcgcagggtattccattatctgatgaagatcgacttccctgg
ctggaacgcttaaatgatgcttcatacagtctttataaaaagaatgaaacaggatttatt
gtctgttcatcattaaaaaaacagtatcgtgatattttacgcaagggtagcccccatgtt
catttcctctggttagatggcgactatgaaactattctcgcgcgaatgcagcgtcgggct
gggcattttatgccggtagcgttactaaaaagtcagtttgaggcactggagcgtccacaa
gcagatgaacaggatattgtgcgcattgatatcaaccatgatattgccaatgtcaccgaa
caatgtcggcaggctgtgctggcgatacgacaaaacagaatatgtgcgaaagagggcagc
gcctcagatcagcgctgcgaatga
              
                            

Download fasta file
RegulonDB