RegulonDB RegulonDB 10.10: Gene Sequence
sieB gene sequence


Size: 489        A: 139  T: 168  G: 84  C: 98

Fasta

 

>sieB E. coli K12. Version NC_000913.3 GI:556503834
atgttggatgtatttactccattgttgaaactttttgctaacgagccactcgaaagactt
atgtatacgattatcatttttggtctcactctctggctgataccgaaagagtttactgtc
gcattcaatgcttatactgaaataccttggctctttcagattatcgtttttgccttttct
ttcgtggtcgccatttccttctcaagattgcgagcacatattcaaaagcattattcatta
ctaccagagcaacgagtattgcttcgtttatctgagaaagaaatcgctgtatttaaagat
ttccttaaaacaggaaatcttattatcacttctccttgccgtaacccggttatgaaaaaa
ttagaacggaagggcatcattcaacatcagagtgatagcgcaaactgttcttattatctc
gtcaccgaaaaatactcccattttatgaagttattctggaacagcaggagtagacgtttt
aatcgttag
              
                            

Download fasta file
RegulonDB