RegulonDB RegulonDB 10.9: Gene Sequence
rdgC gene sequence


Size: 912        A: 246  T: 196  G: 262  C: 208

Fasta

 

>rdgC E. coli K12. Version NC_000913.3 GI:556503834
atgctgtggttcaaaaatttaatggtttaccgtcttagccgcgagatttcgctgcgtgca
gaagagatggaaaaacagctagcctcgatggcatttaccccatgcggcagccaggacatg
gcgaagatgggctgggttcctccgatgggatcgcacagcgatgcgttaacgcacgttgcc
aatggtcaaattgttatctgcgcgcgcaaagaagaaaaaatcctcccgtctccggtgatt
aaacaggcgctggaagcgaaaatcgccaaactggaagcggaacaggcgcgtaagctgaag
aaaaccgaaaaagattcgctgaaagacgaagtgctgcactctctgctgccgcgtgctttc
agccgttttagccagacaatgatgtggatcgacacggttaacggtttgattatggtggac
tgcgccagtgccaaaaaagcggaagatacgctggcattactgcgtaaaagcctggggtcg
ttaccggttgtaccattgagcatggaaaacccgattgaactgacgctgaccgaatgggtt
cgctccggtagtgcggcacagggcttccagctgcttgatgaagccgagctgaaatcgttg
ctggaagatggcggcgtgatccgcgcgaagaaacaagatctgaccagcgaagagatcacc
aatcacattgaagccggaaaagtggtgactaaactggcgctcgactggcagcagcgcatt
cagtttgtgatgtgcgacgatggttcgctcaagcgtctgaagttctgcgacgagctgcgc
gatcaaaacgaagatatcgaccgtgaagatttcgcccagcgttttgatgccgatttcatc
ctgatgactggtgaactggcagcgttaattcaaaacctgattgaaggattaggtggcgaa
gcacaacgttaa
              
                            

Download fasta file
RegulonDB