RegulonDB RegulonDB 10.9: Gene Sequence
eaeH gene sequence


Size: 888        A: 226  T: 233  G: 233  C: 196

Fasta

 

>eaeH E. coli K12. Version NC_000913.3 GI:556503834
atgtcacattataaaacaggtcataaacaaccacgatttcgttattcagttctggcccgc
tgcgtggcgtgggcaaatatctctgttcaggttctttttccactcgctgtcacctttacc
ccagtaatggcggcacgtgcgcagcatgcggttcagccacggttgagcatgggaaatact
acggtaactgctgataataacgtggagaaaaatgtcgcgtcgtttgccgcaaatgccggg
acatttttaagcagtcagccagatagcgatgcgacacgtaactttattaccggaatggcc
acagctaaagctaaccaggaaatacaggagtggctcgggaaatatggtactgcgcgcgtc
aaactgaatgtcgataaagatttctcgctgaaggattcttcgctggaaatgctttatccg
atttatgatacgccgacaaatatgttgttcactcagggggcaatacatcgtacagacgat
cgtactcagtcaaatattggttttggctggcgtcatttttcaggaaatgactggatggcg
ggggtgaatacttttatcgatcatgatttatcccgtagtcatacccgcattggtgttggt
gcggaatactggcgcgattatctgaaactgagcgccaatggttatattcgggcttctggc
tggaaaaaatcgccggatattgaggattatcaggaacgcccggcgaatggctgggatatt
cgtgctgagggctatttacccgcctggccgcagcttggcgcaagcctgatgtatgaacag
tattatggcgatgaagtcgggctgtttggtaaagataagcgccagaaagacccgcatgct
atttctgccgaggtgacctatacgccagtgcctcttacccagcaatag
              
                            

Download fasta file
RegulonDB