RegulonDB RegulonDB 10.9: Gene Sequence
gatR gene sequence


Size: 774        A: 217  T: 198  G: 200  C: 159

Fasta

 

>gatR E. coli K12. Version NC_000913.3 GI:556503834
atgaattcattcgagcgaaggaataagatcatccaattagtgaatgaacagggaaccgtg
cttgttcaggatctggcgggagtatttgctgcctcggaagcgacaatccgtgccgatttg
cgctttctcgaacaaaaaggcgtggttacgcgctttcatggcggtgcggcgaaaataatg
tctggtaatagtgaaaccgagacccaggaagtcgggtttaaagagcgatttcagctcgcc
agcgcgccaaaaaacagaatagcgcaggcggcagtcaaaatgatccacgaagggatgacc
gttattctcgacagcggaagtacgacaatgcttatcgccgaaggattaatgaccgccaaa
aatatcacggtgattaccaacagtctcccggcagcgtttgccctttccgaaaataaagac
attactctggtcgtctgtggtggcacggtccgccataaaacgcgctcgatgcatggttcc
attgccgagcgttcattacaggatattaatgccgatttaatgtttgtcggtgctgatggt
attgatgcggttaatggtattacgacctttaatgaaggttattctattagcggtgcgatg
gtcacagccgctaataaagtgattgccgttctcgattcatcgaaatttaaccgtcgcggt
tttaatcaggtactaccaatcgaaaaaattgacattattattaccgatgatgctgtgtca
gaggtggataaactggcattgcagaagacgcgggtaaaattaattacggtgtag
              
                            

Download fasta file
RegulonDB