RegulonDB RegulonDB 10.9: Gene Sequence
ytjC gene sequence


Size: 648        A: 148  T: 136  G: 199  C: 165

Fasta

 

>ytjC E. coli K12. Version NC_000913.3 GI:556503834
atgttacaggtatacctagtccgccacggtgaaacgcagtggaacgccgagcgacgtatt
cagggccagtctgacagcccgctgaccgccaaaggtgagcaacaggcgatgcaggtggca
acccgtgccaaagagcttggcattacgcatatcatcagtagcgatttaggacgcacccgg
cgtacggcggaaatcatcgcccaggcctgcggctgtgacatcatctttgattctcgcctg
cgtgaattaaacatgggtgtgctggaaaaaagacatatcgattctctgaccgaagaagaa
gagaactggcgtcggcagctggtcaatggcaccgttgacgggcgtattcctgaaggcgag
tcaatgcaggagctcagcgatcgcgtcaatgcggcactggaatcttgccgggacttaccg
cagggaagccgaccgctgctggtgagtcatggtattgcactgggatgcctggtgagtacg
attctcggattaccagcatgggcagagcgccgcttacgtctgcgtaactgttctatttcg
cgcgtggattatcaggaaagcctgtggctggcgtctggctgggtcgttgaaaccgcaggg
gacatctcgcatctggacgcccctgcattagatgagctgcagcgttaa
              
                            

Download fasta file
RegulonDB