RegulonDB RegulonDB 10.9: Gene Sequence
mukF gene sequence


Size: 1323        A: 319  T: 305  G: 377  C: 322

Fasta

 

>mukF E. coli K12. Version NC_000913.3 GI:556503834
atgagtgaattttcccagacagtccccgaactggttgcctgggccagaaaaaatgacttc
tccatctcgctgccggtagaccgactctcttttctgctggcggttgccacgctgaacggc
gagcgtctggatggtgagatgagtgaaggcgagctggtggatgcattccgccatgtgagt
gatgcgtttgagcaaaccagcgaaaccatcggcgtgcgcgccaataacgcgatcaacgac
atggtgcgtcaacgtctgctgaaccgctttaccagcgagcaggcggaagggaacgcaatt
taccgtctgacgccgctcggcatcggcattactgactactacatccgtcagcgcgagttt
tctacgctgcgtctttctatgcagttgtcgattgtggcgggtgagctcaaacgcgcagca
gatgccgccgaagagggcggtgatgaatttcactggcaccgtaatgtctatgcgccactg
aaatattcggtagcagaaattttcgacagtatcgacctgacgcaacgtctgatggacgaa
cagcagcagcaggtgaaggacgatatcgcccagttgctgaacaaagactggcgggcggcg
atttccagctgtgaattgttgctttcggaaacttccggaacgctgcgtgaattgcaggat
acgctggaagcggcaggcgacaaattgcaggctaatctgttgcgcattcaggatgcgacg
atgacccatgacgatctgcatttcgtcgatcgtctggtgttcgatctgcagagcaaactc
gatcgtattatcagttggggccagcaatccatcgacttgtggattggctacgaccgccac
gtacacaaatttattcgtaccgcgatcgatatggataaaaaccgcgtctttgctcagcgg
ttacgtcagtcggtacaaacctattttgatgagccgtgggcgctaacttatgccaatgcc
gatcgtctgctggatatgcgtgacgaagagatggcactgcgcgatgaagaagtgactggg
gaacttcctgaggatctggaatacgaagagtttaacgagatccgcgaacagctggcggcg
atcatcgaagaacaacttgccgtgtacaaaaccagacaagtgccgctggatcttggtctg
gtggtacgcgaatatctgtcacagtatccgcgtgcacgtcactttgacgttgcgcgtatt
gttattgatcaggcggtacgtcttggcgtagcgcaagcagatttcaccggactgccagcg
aaatggcagccgattaatgattacggagccaaggtacaggcgcatgtcatcgacaaatat
tga
              
                            

Download fasta file
RegulonDB