RegulonDB RegulonDB 10.9: Gene Sequence
elyC gene sequence


Size: 780        A: 185  T: 188  G: 218  C: 189

Fasta

 

>elyC E. coli K12. Version NC_000913.3 GI:556503834
atgctttttacactgaaaaaagtgattggcaatatgttgctgccacttccgctgatgttg
ttgattattggcgctggcctggcgctgctgtggtttagccgttttcaaaaaaccgggaag
atttttattagcattgggtggctggcgctcttgttattgagtttgcaaccggtagccgac
cgcctgctgcgtcccatcgaaagcacctatccgacatggaataattcgcaaaaagtggac
tatatcgtggtgctcggaggtggttatacctggaacccgcagtgggcaccgagctctaat
ttaatcaataacagtctgccacgcctgaatgaaggtattcgcttatggcgcgaaaatccg
ggatcaaaactgatcttcacgggaggcgtagcaaaaaccaatacggtgagtacagcggaa
gtaggtgccagagttgcgcaatcgctgggcgtgccgcgcgagcaaattatcaccctggat
ttgccaaaagataccgaagaagaagctgcagcagtgaaacaggcgattggtgacgcccct
ttcctgctggtgacctccgcatcacatctgccgcgggcgatgatcttttttcagcaggaa
gggttaaatccgctaccagccccggcgaatcagttggccatcgactcgccgcttaacccg
tgggaacgggcaatcccttctccggtctggttgatgcatagcgatcgtgttggctatgaa
acgcttggccgtatctggcagtggctaaaaggttcgtcaggcgagccacggcaagagtga
              
                            

Download fasta file
RegulonDB