RegulonDB RegulonDB 11.1: Gene Sequence
cmoM gene sequence


Size: 786        A: 193  T: 188  G: 229  C: 176

Fasta

 

>cmoM E. coli K12. Version NC_000913.3 GI:556503834
atgcaggatcgcaattttgatgatattgcggaaaagttttcccgtaacatttacggcacc
accaaagggcagcttcgacaggctattctgtggcaggatctcgatcgcgtgctggcggaa
atgggcccgcaaaaactgcgtgtgctggatgctggcggtggagaagggcagaccgcaatc
aaaatggccgagcgtgggcatcaggtcattttatgcgatctttctgcgcagatgatcgac
cgcgcaaaacaggcggcagaagcaaaaggtgtgagcgacaacatgcaatttatacattgc
gccgctcaggatgttgcttcgcatttggaaacgcccgttgatctgatattgttccatgcg
gtgctcgagtgggtggctgatccccgcagcgtattgcagaccctctggtcagtgttgcgt
ccaggcggcgtgttgtcgttaatgttctacaatgcgcatggtttgttgatgcataacatg
gtcgccgggaattttgattacgtgcaggcgggaatgccgaaaaagaaaaaacggacgctt
tcgccagattatccacgcgacccggcgcaggtttatctgtggctggaagaagctggttgg
caaattatgggtaagacaggcgttcgcgtgtttcatgattatctgcgcgagaaacaccag
cagcgcgactgctatgaagcattacttgaattagaaacgcgttattgccgtcaggaaccg
tatattaccctggggcgttatattcatgtcaccgcgcgcaaaccgcagagcaaggataaa
gtatga
              
                            

Download fasta file
RegulonDB