RegulonDB RegulonDB 10.9: Gene Sequence
hinT gene sequence


Size: 360        A: 94  T: 84  G: 92  C: 90

Fasta

 

>hinT E. coli K12. Version NC_000913.3 GI:556503834
gtggcagaagaaactatattcagcaaaattattcgtcgtgagatcccctccgatatcgtc
taccaggatgatctggtaacggcgtttcgcgatatttcgccgcaagcgccaacgcatatt
ctgatcattccgaatatcctcattccgactgtgaacgacgtctcagctgagcatgagcag
gcgctgggacgcatgatcaccgtagcggcaaaaattgctgagcaagaaggtattgccgaa
gatggctatcgtctgatcatgaataccaaccgccatggcggacaagaggtttaccacatc
catatgcacttgttgggtggccgtccgctgggaccaatgctggcgcataaaggtctgtaa
              
                            

Download fasta file
RegulonDB