RegulonDB RegulonDB 10.9: Gene Sequence
cutA gene sequence


Size: 339        A: 91  T: 78  G: 80  C: 90

Fasta

 

>cutA E. coli K12. Version NC_000913.3 GI:556503834
atgcttgatgaaaaaagttcgaataccgcgtctgtcgtggtgctatgtacggcaccagat
gaagcgacagcccaggatttagccgccaaagtgctggcggaaaaactggcggcctgcgcg
accttgatccccggcgctacctctctctattactgggaaggtaagctggagcaagaatac
gaagtgcagatgattttaaaaactaccgtatctcaccagcaggcactgctggaatgcctg
aagtctcatcatccatatcaaaccccggaacttctggttttacctgttacacacggagac
acagattacctctcatggctcaacgcatctttacgctga
              
                            

Download fasta file
RegulonDB